scpp5

Ensembl ID:
ENSDARG00000078622
ZFIN ID:
ZDB-GENE-090313-256
Description:
secretory calcium-binding phosphoprotein 5 [Source:RefSeq peptide;Acc:NP_001138708]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16277 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113673 Essential Splice Site 77 180 5 12
ENSDART00000137271 Essential Splice Site 101 204 5 12
Genomic Location (Zv9):
Chromosome 1 (position 44294364)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43210680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCCGCGATTCCCTGCTAATCCAGCAGGAGGAGCAGCGGGAACATCGG[T/C]GAGTCTGTGGTGTTTCTTAACTCCCTCAACTCATTTTAGCTTCTTTTTTW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link