NP_001159802.1

Ensembl ID:
ENSDARG00000078605
Description:
prostaglandin E receptor 1, subtype EP1b [Source:RefSeq peptide;Acc:NP_001159802]
Human Orthologue:
PTGER1
Human Description:
prostaglandin E receptor 1 (subtype EP1), 42kDa [Source:HGNC Symbol;Acc:9593]
Mouse Orthologue:
Ptger1
Mouse Description:
prostaglandin E receptor 1 (subtype EP1) Gene [Source:MGI Symbol;Acc:MGI:97793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31498 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111218 Nonsense 125 373 1 2
Genomic Location (Zv9):
Chromosome 6 (position 9397089)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8163575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGGAGGTGTCCCAGCTGAGGAATACAACAGGGCTGACCCATTATGC[C/T]AGTTCTTAGGAGGCAGTATGGTGTTTTTCGGACTGTGTCCGCTCTTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link