NR_023335.1

Ensembl ID:
ENSDARG00000078604
Description:
wu:fj33d10 (wu:fj33d10), non-coding RNA [Source:RefSeq DNA;Acc:NR_023335]
Human Orthologue:
TBC1D10B
Human Description:
TBC1 domain family, member 10B [Source:HGNC Symbol;Acc:24510]
Mouse Orthologue:
Tbc1d10b
Mouse Description:
TBC1 domain family, member 10b Gene [Source:MGI Symbol;Acc:MGI:1915699]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26099 Nonsense Mutation detected in F1 DNA During 2017
sa6036 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114217 Nonsense 26 849 1 9
Genomic Location (Zv9):
Chromosome 3 (position 32931856)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32663166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCCCTCCTGGTATGGGTGAACAACCAGTGCCTGCTCCCTCCAGCCCA[C/T]AGCCTCTCCCCTCAGAAACTCCCATCCCAAAATCCTCTCTCTATGGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114217 Essential Splice Site 511 849 8 9
Genomic Location (Zv9):
Chromosome 3 (position 32944593)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32675903
KASP Assay ID:
554-3955.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATGTGCCAAATAGAGAGTWTAAATGTATATTTTTGTGTTGTCTGTCA[G/T]GAGTRAAGATCGTGTTTAGGGTGGGTTTGGTGCTCCTCAAGCAGATGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link