myo1hb

Ensembl ID:
ENSDARG00000078603
ZFIN ID:
ZDB-GENE-070705-355
Description:
Novel protein similar to vertebrate myosin IC (MYO1C) [Source:UniProtKB/TrEMBL;Acc:B8JLK6]
Mouse Orthologue:
Myo1h
Mouse Description:
myosin 1H Gene [Source:MGI Symbol;Acc:MGI:1914674]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1578 Essential Splice Site Available for shipment Available now
sa5300 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112968 Essential Splice Site 561 1021 16 31
ENSDART00000142826 Essential Splice Site 535 993 16 30
Genomic Location:
Chromosome 5 (position 33607560)
KASP Assay ID:
554-1521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTGCTTCCACACTATTGAGCCTGATGGCAAGAAAAGACCCGAGACGG[T/C]ACAGTAAAATGATATGTGACAAGTGAATGCATTTTTAATGATGATTTTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa5300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112968 Nonsense 607 1021 18 31
ENSDART00000142826 Nonsense 581 993 18 30
Genomic Location:
Chromosome 5 (position 33609400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTCTCACCCGACCTCAGATCGCTTTGATGATGTCATGGTGAGACAT[C/T]AAGTCAAGTATCTGGGGTTAATGGAGCACCTGAGAGTCAGACGGGCCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zy1adrrn