NP_001159763.1

Ensembl ID:
ENSDARG00000078602
Description:
prostaglandin E2 receptor subtype EP1-like protein [Source:RefSeq peptide;Acc:NP_001159763]
Human Orthologue:
PTGER1
Human Description:
prostaglandin E receptor 1 (subtype EP1), 42kDa [Source:HGNC Symbol;Acc:9593]
Mouse Orthologue:
Ptger1
Mouse Description:
prostaglandin E receptor 1 (subtype EP1) Gene [Source:MGI Symbol;Acc:MGI:97793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13334 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111510 Nonsense 115 376 1 2
Genomic Location (Zv9):
Chromosome 3 (position 53167030)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52274345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGGGCTCTGGCTCTTAACCTCCACCTGGAAAGGGTAAAGCATCACGGW[C/T]AGATGGAAGTGGAGCCTCCYCGGATYTACTGCAAGCTTTTTGGAGCTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link