si:ch1073-184j22.2

Ensembl ID:
ENSDARG00000078598
ZFIN IDs:
ZDB-GENE-081104-32, ZDB-GENE-090218-31, ZDB-GENE-090218-31
Description:
Novel dual specificity phosphatase catalytic domain containing protein [Source:UniProtKB/TrEMBL;Acc:
Human Orthologues:
DUSP14, DUSP18, DUSP21
Human Descriptions:
dual specificity phosphatase 14 [Source:HGNC Symbol;Acc:17007]
dual specificity phosphatase 18 [Source:HGNC Symbol;Acc:18484]
dual specificity phosphatase 21 [Source:HGNC Symbol;Acc:20476]
Mouse Orthologues:
Dusp14, Dusp18, Dusp21
Mouse Descriptions:
dual specificity phosphatase 14 Gene [Source:MGI Symbol;Acc:MGI:1927168]
dual specificity phosphatase 18 Gene [Source:MGI Symbol;Acc:MGI:1922469]
dual specificity phosphatase 21 Gene [Source:MGI Symbol;Acc:MGI:1920797]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39757 Nonsense Mutation detected in F1 DNA During 2017
sa32834 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114518 Nonsense 99 215 2 2
ENSDART00000132411 Nonsense 78 194 1 1
Genomic Location (Zv9):
Chromosome 2 (position 5041166)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5486894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGACCTTCCAAATGCTCGTCTGGGGGACCACTTTGACCACGTCTCCGCT[C/T]GAATTCACAACAACAGACCTGGAGGAACCCTAGTGCACTGTGCTGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114518 Nonsense 176 215 2 2
ENSDART00000132411 Nonsense 155 194 1 1
Genomic Location (Zv9):
Chromosome 2 (position 5040935)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5486663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGATTACGAGAGGAAACTCTACGGTAGGAATACTGTGAGAGTGGCT[G/T]AACCCGTGGATGCACAGCCAACGCCACAAACACCAAAACTACCCTCCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link