si:dkey-18l1.1

Ensembl ID:
ENSDARG00000078593
ZFIN ID:
ZDB-GENE-070912-407
Description:
Uncharacterized protein KIAA0564 homolog [Source:UniProtKB/Swiss-Prot;Acc:B0R0T1]
Human Orthologue:
KIAA0564
Human Description:
KIAA0564 [Source:HGNC Symbol;Acc:29071]
Mouse Orthologue:
1300010F03Rik
Mouse Description:
RIKEN cDNA 1300010F03 gene Gene [Source:MGI Symbol;Acc:MGI:1919008]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30915 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2515 Nonsense F2 line generated During 2017
sa16132 Essential Splice Site Available for shipment Available now
sa34601 Nonsense Mutation detected in F1 DNA During 2017
sa41388 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111563 Essential Splice Site 397 1903 11 46
ENSDART00000146706 Essential Splice Site 397 1896 11 45
Genomic Location (Zv9):
Chromosome 9 (position 18273834)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17749904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGATCAATCTTTTTTTCCCTGTAAAGGAAATGCTGTACTTTCTCCACA[G/A]GTTCCTTCAGGGACACGGCCGATTCGCCCACCCAACAGCAGTCCCACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2515
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111563 Nonsense 971 1903 25 46
ENSDART00000146706 Nonsense 966 1896 25 45
Genomic Location (Zv9):
Chromosome 9 (position 18204360)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17680430
KASP Assay ID:
554-3223.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGGAGAGCTTCGGGCCATGGCTGACCAGGGAACAATCACATACCCCTA[C/A]TCTACACGAGAGGTGGTAAACATCGTAAAACATCTACAGGTAATCAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111563 Essential Splice Site 1072 1903 None 46
ENSDART00000146706 Essential Splice Site 1067 1896 None 45
Genomic Location (Zv9):
Chromosome 9 (position 18184699)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17660769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KGCAGTTTCAGTTYATTGTTTAGTTYATTGTGCTGTTTKTGGTGCTCTTY[A/C]GGGCCCAGTGTTWCTCCGGGTTCAGAGTTAYCCTTCTRAAAGACATGART
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111563 Nonsense 1148 1903 29 46
ENSDART00000146706 Nonsense 1141 1896 29 45
Genomic Location (Zv9):
Chromosome 9 (position 18182541)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17658611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTATGCTATGAAGGAGAAAGGAGACTCGGTACAGTGTATAGAGCTCTA[T/A]GACATCTTTCCCAGGACCATCAGTGGAGTTTGGCAGCCCTTCGTCTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111563 Essential Splice Site 1223 1903 31 46
ENSDART00000146706 Essential Splice Site 1216 1896 30 45
Genomic Location (Zv9):
Chromosome 9 (position 18176837)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17652907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAGCGCCACGGAAGACCTCAAACTGGTGGAACAGCAAAGAGAGTCAG[G/A]TGGAAATCTGCATCAGGACCAGTGCTTCTCAACCATATAGGAGCCTTAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link