nomo

Ensembl ID:
ENSDARG00000078592
ZFIN ID:
ZDB-GENE-040826-3
Human Orthologues:
NOMO1, NOMO2, NOMO3
Human Descriptions:
NODAL modulator 1 [Source:HGNC Symbol;Acc:30060]
NODAL modulator 2 [Source:HGNC Symbol;Acc:22652]
NODAL modulator 3 [Source:HGNC Symbol;Acc:25242]
Mouse Orthologue:
Nomo1
Mouse Description:
nodal modulator 1 Gene [Source:MGI Symbol;Acc:MGI:2385850]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26716 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33836 Nonsense Mutation detected in F1 DNA During 2017
sa7035 Nonsense Mutation detected in F1 DNA During 2017
sa10937 Nonsense Available for shipment Available now
sa15655 Essential Splice Site Available for shipment Available now
sa26715 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Essential Splice Site 85 1217 4 33
Genomic Location (Zv9):
Chromosome 6 (position 16699170)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16590233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTGTGCACCAATCAATGGTTACTTCATGATCCCACTGTATGACAAGG[T/C]ACAGTAACTCACGTACTGGAATGAATGGATTGACTGGGTGGATTATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Nonsense 425 1217 14 33
Genomic Location (Zv9):
Chromosome 6 (position 16682787)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16573850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTGTTTGTGGTCACATCTCCGTCACCCGTCTTCCAGAGACTGTTAAA[C/T]AGCTTGGACGCTACAAAGTTACACTTTCGGCTCAGAGGCAGGATCAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Nonsense 635 1217 19 33
Genomic Location (Zv9):
Chromosome 6 (position 16677988)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16569051
KASP Assay ID:
554-4969.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAGAGACTAAAGTATGTAACTTACTACTGTKTAATTAAAGGTGTYTA[T/G]AAAGTGACTCCACGCTCCTGTCACCAGTTTGAACAGGATTACTACACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Nonsense 746 1217 21 33
Genomic Location (Zv9):
Chromosome 6 (position 16673823)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16564886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCCCCTGTGGAAGAGAAACCAGAGGAACTTCGTGAGCCTTTTCACTA[T/G]GAATTCTCCTATTGGGCACGGTAGGATAATAGGAGAAAGCTTGTCATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Essential Splice Site 780 1217 22 33
Genomic Location (Zv9):
Chromosome 6 (position 16673597)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16564660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGAATTTCTGTTTTACCCTCCTGAAGTAGAGGCTACAATCACTGGTG[G/A]TGAGAGTGCAAACTTTGTTTTAAAGGAATGAATGAACTCAGTTGGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Essential Splice Site 1032 1217 28 33
Genomic Location (Zv9):
Chromosome 6 (position 16666140)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16557203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAAATGATCACATAGAGAGAGCATTGCCACCACACAAGACAATTGAG[G/A]TGAGCGTTCACATTTATACAGTATTCATCTTAGTTTTGGTTTAAACCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link