mon1a

Ensembl ID:
ENSDARG00000078585
ZFIN ID:
ZDB-GENE-070615-6
Description:
vacuolar fusion protein MON1 homolog A [Source:RefSeq peptide;Acc:NP_001092240]
Human Orthologue:
MON1A
Human Description:
MON1 homolog A (yeast) [Source:HGNC Symbol;Acc:28207]
Mouse Orthologue:
Mon1a
Mouse Description:
MON1 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1920075]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21950 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110839 Nonsense 204 525 4 7
Genomic Location:
Chromosome 11 (position 36018349)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCCTGGTGGGAGTCTCTCGCACAAGCTGTTCAGACCGGGAATTAACA[C/T]GAGAGCTTCAGTATGTGTATTTCCAGATAGTCAGCCTGCTCACCCTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p5dz2jro