myo16

Ensembl ID:
ENSDARG00000078582
ZFIN ID:
ZDB-GENE-070912-470
Description:
Novel protein similar to vertebrate myosin XVI (MYO16) [Source:UniProtKB/TrEMBL;Acc:B0V082]
Human Orthologue:
MYO16
Human Description:
myosin XVI [Source:HGNC Symbol;Acc:29822]
Mouse Orthologue:
Myo16
Mouse Description:
myosin XVI Gene [Source:MGI Symbol;Acc:MGI:2685951]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31701 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16381 Nonsense Available for shipment Available now
sa30913 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109288 Essential Splice Site 451 1867 11 36
ENSDART00000133063   None 339 None 8
ENSDART00000138167 Essential Splice Site 88 1471 2 25
Genomic Location (Zv9):
Chromosome 9 (position 8042877)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8022720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCTGCTCTACGAGATGCAGAAGCGCTTCGCCAATGACCAGATTTATG[T/A]ACGTAGCAAAATACGTGGTGTGTCAGAGTTCTGTTAACAATCTAAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109288 Nonsense 808 1867 21 36
ENSDART00000133063   None 339 None 8
ENSDART00000138167 Nonsense 445 1471 12 25
Genomic Location (Zv9):
Chromosome 9 (position 8090970)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8070813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGCCCTWGAGATMAGCATCCTGGACATCTTTGGCTTTGAGGAATTC[C/T]AACGCAACGCTTATGAACAGGTAAAGGGGAGAGTGATGCGATGACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109288 Nonsense 1675 1867 32 36
ENSDART00000133063   None 339 None 8
ENSDART00000138167 Nonsense 1294 1471 23 25
Genomic Location (Zv9):
Chromosome 9 (position 8164374)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8144217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTACCGCCCCCCTTCTCACTTCCCCTTCCCCCCTGAGCCGAACTTCT[T/A]GGCCCTGACTCGTGCAGCTTCTGTGGCTAGCACAGAATCCCCCAAAGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link