myo16

Ensembl ID:
ENSDARG00000078582
ZFIN ID:
ZDB-GENE-070912-470
Description:
Novel protein similar to vertebrate myosin XVI (MYO16) [Source:UniProtKB/TrEMBL;Acc:B0V082]
Human Orthologue:
MYO16
Human Description:
myosin XVI [Source:HGNC Symbol;Acc:29822]
Mouse Orthologue:
Myo16
Mouse Description:
myosin XVI Gene [Source:MGI Symbol;Acc:MGI:2685951]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16381 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109288 Nonsense 808 1867 21 36
ENSDART00000133063 None None 339 None 8
ENSDART00000138167 Nonsense 445 1471 12 25
Genomic Location:
Chromosome 9 (position 8090970)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGCCCTWGAGATMAGCATCCTGGACATCTTTGGCTTTGAGGAATTC[C/T]AACGCAACGCTTATGAACAGGTAAAGGGGAGAGTGATGCGATGACAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aqfpplxw