C17orf63 (1 of 2)

Ensembl ID:
ENSDARG00000078578
Description:
chromosome 17 open reading frame 63 [Source:HGNC Symbol;Acc:25563]
Human Orthologue:
C17orf63
Human Description:
chromosome 17 open reading frame 63 [Source:HGNC Symbol;Acc:25563]
Mouse Orthologue:
BC017647
Mouse Description:
cDNA sequence BC017647 Gene [Source:MGI Symbol;Acc:MGI:2384939]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35839 Nonsense Available for shipment Available now
sa28422 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111228 Nonsense 209 596 2 2
Genomic Location (Zv9):
Chromosome 15 (position 15400567)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16445530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCCAGGCTCACCAACCGCCAGTACCACACCACACCCTAAACCACCAA[C/T]AGACTCTCATGCAGCAGCAGTTGTCCGCTCCACAAGGACTACGGCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111228 Nonsense 362 596 2 2
Genomic Location (Zv9):
Chromosome 15 (position 15400106)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16445069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGCTCTCGAGTGTGCCCACATCCTACTGTGGGTCCTCCATCTTCTTG[C/A]ATTCTTGGAAATTCTGACAAAGGCGGTCCTGCCTCTGCTCTGCCACTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link