setd5

Ensembl ID:
ENSDARG00000078576
ZFIN ID:
ZDB-GENE-080523-1
Description:
SET domain containing 5 [Source:UniProtKB/TrEMBL;Acc:A5XCC2]
Human Orthologue:
SETD5
Human Description:
SET domain containing 5 [Source:HGNC Symbol;Acc:25566]
Mouse Orthologue:
Setd5
Mouse Description:
SET domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1920145]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40686 Nonsense Mutation detected in F1 DNA During 2017
sa40685 Nonsense Mutation detected in F1 DNA During 2017
sa20695 Nonsense Available for shipment Available now
sa40684 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 448 1461 11 24
Genomic Location (Zv9):
Chromosome 6 (position 23499804)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19755250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTTTGTATATTGAGTGTTTTCTTCTGAATCTCCCCACAGTAATTA[T/G]AAAGTGGATTGTGCATGTCACAAGGGCAATCAAGACTGTCCTGTACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 480 1461 11 24
Genomic Location (Zv9):
Chromosome 6 (position 23499710)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19755156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGAGACACAATCTCCGTCCCCTCGAACTGCTGTCCCCTCAGCCTTCA[C/T]AATTTGCCCTGCCTGGAGCAGAGACACGGAGGAGACGAGCGCGACGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 494 1461 11 24
Genomic Location (Zv9):
Chromosome 6 (position 23499668)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19755114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTTCACAATTTGCCCTGCCTGGAGCAGAGACACGGAGGAGACGAGCG[C/T]GACGCAGAGAGCTGGAAGGGGACAAACTCGTAACGGGTATATCCGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 701 1461 14 24
Genomic Location (Zv9):
Chromosome 6 (position 23497549)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19752995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTGTGGTGGGTGGCGAAGAGGGTAGTGCAGCAGCAGGCCTCAAGGAA[C/T]AGGGCCAGGGAGAGGGAGCTCCAAACTGTGGTCATCTCCAAGATGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link