si:dkey-21c19.3

Ensembl ID:
ENSDARG00000078574
ZFIN ID:
ZDB-GENE-030131-6462
Human Orthologue:
SENP1
Human Description:
SUMO1/sentrin specific peptidase 1 [Source:HGNC Symbol;Acc:17927]
Mouse Orthologue:
Senp1
Mouse Description:
SUMO1/sentrin specific peptidase 1 Gene [Source:MGI Symbol;Acc:MGI:2445054]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14994 Nonsense Available for shipment Available now
sa18189 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110670 Nonsense 205 729 5 18

The following transcripts of ENSDARG00000078574 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 26064071)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25850191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAATTTACCATCTTCCTCCACKCCAAAACCATCCCCATCTCCAMGCT[T/A]GGGCAGGTCCCTTTATCACCGACCACAAAGGTTGAGTTAMAAATATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110670 Nonsense 650 729 16 18

The following transcripts of ENSDARG00000078574 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 26059541)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25845661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTATGCACAAGAAGTATCTTAATTGTGATTCTGTATTCCAGAAATTA[T/A]CTGAAACAAGAAAGTGAAGACAAAAAAGGACAAAAAATGGAAACCTCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link