si:dkey-20d21.7

Ensembl ID:
ENSDARG00000078571
ZFIN ID:
ZDB-GENE-081104-368
Description:
WD repeat-containing protein 6 [Source:RefSeq peptide;Acc:NP_001107126]
Human Orthologue:
WDR6
Human Description:
WD repeat domain 6 [Source:HGNC Symbol;Acc:12758]
Mouse Orthologue:
Wdr6
Mouse Description:
WD repeat domain 6 Gene [Source:MGI Symbol;Acc:MGI:1930140]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17163 Nonsense Available for shipment Available now
sa11539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112275 Nonsense 900 1193 2 6
ENSDART00000140798 Nonsense 900 1193 3 7
Genomic Location (Zv9):
Chromosome 8 (position 27088582)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26216500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAAGTCACTCAGATTGCTGGCCATCGATTAGATGAGCAGTGGGAACGA[A/T]AGCGGAACCGACACAAGACTGTCAAAATGGACCCAGAGACGAGGTRTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112275 Nonsense 1097 1193 6 6
ENSDART00000140798 Nonsense 1097 1193 7 7
Genomic Location (Zv9):
Chromosome 8 (position 27093065)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26220983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGTCGATACCCCTGGCACATTCCTCCCCTCTCACTGGCTTGTGTTTAT[T/G]AAGCCCCGCTCTCCTGGCGWCCACTTCACYGGACCAGCGCATGYGTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link