si:ch211-76m11.8

Ensembl ID:
ENSDARG00000078570
ZFIN ID:
ZDB-GENE-041210-280
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q5RGC8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19533 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108632 Essential Splice Site 791 966 7 7
ENSDART00000147906   None 705 None 5
Genomic Location (Zv9):
Chromosome 1 (position 37719637)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 69366833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACACACACACACAGCTGTGGTTGTAAATGTGTGTGTTCTTGTGTTC[A/T]GATGTCTGTTTGCTCACTCTGGATCCAAACACAGCAGACACTCAACTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link