GLP2R

Ensembl ID:
ENSDARG00000078548
Description:
glucagon-like peptide 2 receptor [Source:HGNC Symbol;Acc:4325]
Human Orthologue:
GLP2R
Human Description:
glucagon-like peptide 2 receptor [Source:HGNC Symbol;Acc:4325]
Mouse Orthologue:
Glp2r
Mouse Description:
glucagon-like peptide 2 receptor Gene [Source:MGI Symbol;Acc:MGI:2136733]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3818 Nonsense Mutation detected in F1 DNA During 2014
sa13102 Nonsense Available for shipment Available now
sa10676 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109713 Nonsense 85 493 3 13
Genomic Location:
Chromosome 12 (position 340267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGCTACTGGAAAYGTCTATAAGGAATGCACCGTCAACGGCACTTGG[A/T]AAACTGAGGAGAACTCCTCCASCGTATGGAGAAATCAGTCAGAGTGCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109713 Nonsense 95 493 3 13
Genomic Location:
Chromosome 12 (position 340237)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCGTCAACGGCACTTGGWAAACTGAGGAGAACTCCTCCASCGTATGG[A/T]GAAATCAGTCAGAGTGCGAAAACCATTAWTTTTTCAAGTCCGAGGTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109713 Nonsense 104 493 3 13
Genomic Location:
Chromosome 12 (position 340208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAACTCCTCCASCGTATGGAGAAATCAGTCAGAGTGCGAAAACCATTA[T/A]TTTTTCAAGTCCGAGGTGAATATTGCAGCCATACAGTGACGTATGGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/md26qu7t