si:ch211-264f5.2

Ensembl ID:
ENSDARG00000078547
ZFIN ID:
ZDB-GENE-080303-2
Description:
hypothetical protein LOC570749 [Source:RefSeq peptide;Acc:NP_001091723]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36770 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112211 Nonsense 15 409 1 7
Genomic Location (Zv9):
Chromosome 19 (position 6291869)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5750724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCCACATGGCTTTTCTGCTGCGTACCCTAGTGCTGCTTTTAGGAGTT[C/T]AAGGTAAGACAATCTTTAGGGTAATATATATATATACATATACATATATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link