cars2

Ensembl ID:
ENSDARG00000078546
ZFIN ID:
ZDB-GENE-030131-5564
Human Orthologue:
CARS2
Human Description:
cysteinyl-tRNA synthetase 2, mitochondrial (putative) [Source:HGNC Symbol;Acc:25695]
Mouse Orthologue:
Cars2
Mouse Description:
cysteinyl-tRNA synthetase 2 (mitochondrial)(putative) Gene [Source:MGI Symbol;Acc:MGI:1919191]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3371 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113735 Nonsense 345 566 10 15

The following transcripts of ENSDARG00000078546 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 28122202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAGGATTTTCTGGCATCTTATACTGCTAATGAGTTTCGACTTTTCTG[T/A]CTTCTGACCAAATACAGATCAGGTACGTTACATGCTAAAAAGTACACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z7ymga4h