inpp5ja

Ensembl ID:
ENSDARG00000078542
ZFIN ID:
ZDB-GENE-091117-4
Human Orthologue:
INPP5J
Human Description:
inositol polyphosphate-5-phosphatase J [Source:HGNC Symbol;Acc:8956]
Mouse Orthologue:
Inpp5j
Mouse Description:
inositol polyphosphate 5-phosphatase J Gene [Source:MGI Symbol;Acc:MGI:2158663]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108588 Essential Splice Site 575 789 9 12
ENSDART00000143215 Essential Splice Site 346 399 9 11
Genomic Location:
Chromosome 10 (position 6868523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACATGGCTTTCAGAGGARTTCATGGGACTGGGTGGGCCTGTACAAGG[T/A]AATCCATGGCATTTTCACGTAAACTACTAATCAAGTGGGTACAGGCTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bab1icwi