inpp5ja

Ensembl ID:
ENSDARG00000078542
ZFIN ID:
ZDB-GENE-091117-4
Human Orthologue:
INPP5J
Human Description:
inositol polyphosphate-5-phosphatase J [Source:HGNC Symbol;Acc:8956]
Mouse Orthologue:
Inpp5j
Mouse Description:
inositol polyphosphate 5-phosphatase J Gene [Source:MGI Symbol;Acc:MGI:2158663]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34839 Nonsense Mutation detected in F1 DNA During 2016
sa17484 Essential Splice Site Available for shipment Available now
sa34838 Nonsense Mutation detected in F1 DNA During 2016
sa34837 Nonsense Mutation detected in F1 DNA During 2016
sa30650 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108588 Nonsense 53 789 1 12
ENSDART00000143215   None 399 None 11
Genomic Location (Zv9):
Chromosome 10 (position 6894480)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7907280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCATCAAACTGCCAGATGGGCACAACTGGAAAGCCACCAATGTTGGAA[C/T]AGACCCCGGTGCCGCAAACAAACCCAGGCGTTAAGGAGAGAGCCAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108588 Essential Splice Site 575 789 9 12
ENSDART00000143215 Essential Splice Site 346 399 9 11
Genomic Location (Zv9):
Chromosome 10 (position 6868523)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7881323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACATGGCTTTCAGAGGARTTCATGGGACTGGGTGGGCCTGTACAAGG[T/A]AATCCATGGCATTTTCACGTAAACTACTAATCAAGTGGGTACAGGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108588 Nonsense 657 789 12 12
ENSDART00000143215   None 399 None 11
Genomic Location (Zv9):
Chromosome 10 (position 6860340)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7873140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGCACCAGCATGTCGTTCACGCTCTGATAGTTCGGATGTGAGCTCT[G/T]AAGATGACAGTACACTCGTCCTGTTGGCCCCGAGCTCACGCAGCCCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108588 Nonsense 680 789 12 12
ENSDART00000143215   None 399 None 11
Genomic Location (Zv9):
Chromosome 10 (position 6860271)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7873071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTTGGCCCCGAGCTCACGCAGCCCCAGCCCTGGAAACCACAGCGGC[A/T]AACGCCACCACCACCAGAAGCGCCAGCGGAGCCGCAGTCCCGCTGTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108588 Nonsense 742 789 12 12
ENSDART00000143215   None 399 None 11
Genomic Location (Zv9):
Chromosome 10 (position 6860084)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7872884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCCTTCAACCAATGCCAAGAAGGAGCGTCTGGTTTCTCCGGACTCAT[T/G]AACCTCACCCTCCCTCAGTCCTCTTAGTCCGAGGAGCCCAGGATCACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link