LOC100332380

Ensembl ID:
ENSDARG00000078541
Human Orthologue:
LASS3
Human Description:
LAG1 homolog, ceramide synthase 3 [Source:HGNC Symbol;Acc:23752]
Mouse Orthologue:
Lass3
Mouse Description:
LAG1 homolog, ceramide synthase 3 Gene [Source:MGI Symbol;Acc:MGI:2681008]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20862 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113396 Nonsense 124 380 3 10
Genomic Location (Zv9):
Chromosome 7 (position 10749083)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 9682146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATGCGGCTGGTCGAGTAGACAAGTGGAGCGCTGGTTCAGGAGGAGA[C/T]GAAACCAGGACCGGCCCGGGGTTCTCAAAAAATTCAGAGAGGCCAGGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link