si:ch211-158d24.2

Ensembl ID:
ENSDARG00000078536
ZFIN ID:
ZDB-GENE-081105-115
Description:
Novel protein similar to vertebrate multiple EGF-like-domains 9 (MEGF9) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
MEGF9
Human Description:
multiple EGF-like-domains 9 [Source:HGNC Symbol;Acc:3234]
Mouse Orthologue:
Megf9
Mouse Description:
multiple EGF-like-domains 9 Gene [Source:MGI Symbol;Acc:MGI:1918264]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13137 Nonsense Available for shipment Available now
sa21358 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114651 Nonsense 276 548 4 6
ENSDART00000142377 Nonsense 333 605 4 6
Genomic Location (Zv9):
Chromosome 8 (position 43626529)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41580101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTCAGGTATCTGTTTGGACTGTCAGGACAACACTCAGGGTCACAACTG[T/A]GAGGAGTGTCTGCCCAGTTTTTATCGGCGTGGTGGCGAAGGGTCAGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114651 Nonsense 389 548 5 6
ENSDART00000142377 Nonsense 446 605 5 6
Genomic Location (Zv9):
Chromosome 8 (position 43640809)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 41594381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTCAACCACACAACGGGAGCTCACTGTGAGATCTGTGCTCGTGGATA[C/A]ACGGGGGACGCCCGACGTCACAACTGCACCCTGAGAGGTATGATGCATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link