lrrcc1

Ensembl ID:
ENSDARG00000078535
ZFIN ID:
ZDB-GENE-041111-207
Description:
Novel protein similar to vertebrate leucine rich repeat and coiled-coil domain containing 1 (LRRCC1)
Human Orthologue:
LRRCC1
Human Description:
leucine rich repeat and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:29373]
Mouse Orthologue:
Lrrcc1
Mouse Description:
leucine rich repeat and coiled-coil domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918960]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19792 Nonsense Available for shipment Available now
sa39854 Nonsense Mutation detected in F1 DNA During 2016
sa19791 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32950 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113498 Nonsense 109 997 4 19
ENSDART00000142366   None 555 None 10
Genomic Location (Zv9):
Chromosome 2 (position 31425353)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31726313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACAAATGTGTATGAAGTCTCTGTTCTGTGGTTTTAGGTCTCTTGTA[T/A]CTTCATGGAGCAAACTACAAACTGAAGTACCTGCAGCTTCACAGCAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113498 Nonsense 216 997 5 19
ENSDART00000142366   None 555 None 10
Genomic Location (Zv9):
Chromosome 2 (position 31423760)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31724720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTGAGGACTTCCTAGAGTTTTTGATTTCATCAGACACTAGTGTGAAT[G/T]GAGAACTGGTAAACTAGTTTTACTATGCTTCATAATTTCCTGTATTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113498 Essential Splice Site 443 997 9 19
ENSDART00000142366   None 555 None 10
Genomic Location (Zv9):
Chromosome 2 (position 31419151)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31720111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCGAGGAAAAAGACCTGCAGAGTTTGGCCTTACACACCACAGACAG[G/A]TCAGGACAAACAGACAAATGCAGTTTCACTTTGTTCCAGTTGTTACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113498 Nonsense 605 997 12 19
ENSDART00000142366 Nonsense 163 555 3 10
Genomic Location (Zv9):
Chromosome 2 (position 31414206)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31715266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGACTGATCTTGAAGAAAAAATCAGGGATGCCAGAAGACAGTA[T/A]GCTGCTCTGGAGGAGGAGTTTCGCATGGCTCTCACTATTGAAGCAAAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link