lrrcc1

Ensembl ID:
ENSDARG00000078535
ZFIN ID:
ZDB-GENE-041111-207
Description:
Novel protein similar to vertebrate leucine rich repeat and coiled-coil domain containing 1 (LRRCC1)
Human Orthologue:
LRRCC1
Human Description:
leucine rich repeat and coiled-coil domain containing 1 [Source:HGNC Symbol;Acc:29373]
Mouse Orthologue:
Lrrcc1
Mouse Description:
leucine rich repeat and coiled-coil domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918960]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19792 Nonsense Mutation detected in F1 DNA During 2014
sa19791 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113498 Nonsense 109 997 4 19
ENSDART00000142366 None None 555 None 10
Genomic Location:
Chromosome 2 (position 31425353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACAAATGTGTATGAAGTCTCTGTTCTGTGGTTTTAGGTCTCTTGTA[T/A]CTTCATGGAGCAAACTACAAACTGAAGTACCTGCAGCTTCACAGCAATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113498 Essential Splice Site 443 997 9 19
ENSDART00000142366 None None 555 None 10
Genomic Location:
Chromosome 2 (position 31419151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCGAGGAAAAAGACCTGCAGAGTTTGGCCTTACACACCACAGACAG[G/A]TCAGGACAAACAGACAAATGCAGTTTCACTTTGTTCCAGTTGTTACCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mmh8y98m