si:ch1073-436c4.1

Ensembl ID:
ENSDARG00000078529
ZFIN ID:
ZDB-GENE-081031-45
Description:
Novel protein similar to H.sapiens BAI1, brain-specific angiogenesis inhibitor 1 (BAI1) [Source:UniP
Human Orthologue:
BAI1
Human Description:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
Mouse Orthologue:
Bai1
Mouse Description:
brain-specific angiogenesis inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1933736]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23396 Essential Splice Site Available for shipment Available now
sa23397 Nonsense Available for shipment Available now
sa11442 Nonsense Available for shipment Available now
sa9373 Nonsense Mutation detected in F1 DNA During 2017
sa7457 Missense Mutation detected in F1 DNA During 2017
sa43190 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Essential Splice Site 294 1493 3 30
ENSDART00000133757   None 283 None 6
ENSDART00000141359   None 254 None 7
ENSDART00000143118   None 269 None 5
ENSDART00000144323   None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 19983)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 102868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGCGTGACTCTGACGGCACCCTCATGGCTAACCAGGCCCCTCAGAAAG[G/A]TGTGTTTCTATGGCAACACTAAATCTGCTCCAGCCGGCAGCAGAGCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Nonsense 328 1493 4 30
ENSDART00000133757   None 283 None 6
ENSDART00000141359   None 254 None 7
ENSDART00000143118   None 269 None 5
ENSDART00000144323 Nonsense 78 331 2 7
Genomic Location (Zv9):
Chromosome 19 (position 20167)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 102684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCGGTGAGGGCTGGCAGTCTCGCACCCGCTCCTGCATGAACTCCGCT[C/T]AGTGTATCGGCCCTTTAAGAGAGAACCGACCCTGCAACAACACCGCCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Nonsense 576 1493 9 30
ENSDART00000133757   None 283 None 6
ENSDART00000141359   None 254 None 7
ENSDART00000143118   None 269 None 5
ENSDART00000144323 Nonsense 323 331 7 7
Genomic Location (Zv9):
Chromosome 19 (position 21525)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 101326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGGGTCTGGCCTTCTGGGAAAACCCCACTCACATCAAATGCGTCTCT[A/T]AAGACTTCCAGGAGATCCAGAGCTTGGTAAGAGAGASAGACASACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Nonsense 907 1493 21 30
ENSDART00000133757 Nonsense 40 283 2 6
ENSDART00000141359 Nonsense 39 254 3 7
ENSDART00000143118   None 269 None 5
ENSDART00000144323   None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 26208)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 96643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGCTGAAGCTAATGTGGAGTGTTTCCCTCCTCAGGTACAWCCGCTCT[G/T]AGCGATCCRTKATCCTGWTCAACTTCTGCCTGWCCATCATCTKCTCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Missense 1307 1493 27 30
ENSDART00000133757   None 283 None 6
ENSDART00000141359   None 254 None 7
ENSDART00000143118 Missense 67 269 1 5
ENSDART00000144323   None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 27950)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 94901
KASP Assay ID:
554-4041.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGTACAACATCAGCACCGACCTTCCGCAGGCACGCCTCATGCACATT[A/T]GCGGWACCTACGCCGAGCCGCAAGCTGCCTACGCCACGCAGACGCTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Essential Splice Site 1380 1493 27 30
ENSDART00000133757   None 283 None 6
ENSDART00000141359   None 254 None 7
ENSDART00000143118 Essential Splice Site 140 269 1 5
ENSDART00000144323   None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 28172)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 94679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTCCAAGAGTGAGACCATCTCCACACTGTCCATGAGCTCCCTGGAG[G/T]TCAGCGAAGGGGTACGAGACTGCTCCACTGCTCAACCATCATTCTGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link