PARP6 (1 of 4)

Ensembl ID:
ENSDARG00000078528
Description:
poly (ADP-ribose) polymerase family, member 6 [Source:HGNC Symbol;Acc:26921]
Human Orthologue:
PARP6
Human Description:
poly (ADP-ribose) polymerase family, member 6 [Source:HGNC Symbol;Acc:26921]
Mouse Orthologue:
Parp6
Mouse Description:
poly (ADP-ribose) polymerase family, member 6 Gene [Source:MGI Symbol;Acc:MGI:1914537]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36551 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114712 Nonsense 272 291 11 11
Genomic Location (Zv9):
Chromosome 18 (position 446155)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 860698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGTCTTAGGTATGAAGACGGTCAGGTGGGAGATGCTAATATTAACACA[C/T]AGGAGCCCAAAATCCAGAAGGAGATCATGCGTGTGATCGGCACTCAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link