lingo4b

Ensembl ID:
ENSDARG00000078527
ZFIN ID:
ZDB-GENE-091214-3
Description:
leucine rich repeat and Ig domain containing 4b [Source:RefSeq peptide;Acc:NP_001082850]
Human Orthologue:
LINGO4
Human Description:
leucine rich repeat and Ig domain containing 4 [Source:HGNC Symbol;Acc:31814]
Mouse Orthologue:
Lingo4
Mouse Description:
leucine rich repeat and Ig domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2444651]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42748 Nonsense Mutation detected in F1 DNA During 2016
sa8790 Nonsense Mutation detected in F1 DNA During 2016
sa39106 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047931 Nonsense 133 604 1 1
Genomic Location:
Chromosome 16 (position 31718648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTCTCAAGATCCTGCCAGTCGGGGTTTTCTCCGGCCTCTCCAACCTT[C/T]GACGTCTGGATATCAGTGAGAATGAGATCCTGGTTTTCCTGGATTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047931 Nonsense 446 604 1 1
Genomic Location:
Chromosome 16 (position 31717708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGACTGCAAAGCAGATGGCTATCCATCACCGTCTATAACCTGGCTGT[C/A]AGCCCAACAGTCTGCACTTAGCTCTGCCGGGAGAGTACGAGTGCTTACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047931 Nonsense 591 604 1 1
Genomic Location:
Chromosome 16 (position 31717274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACACTGCCACAATAGACTTTGTGCCACGATCATCTATGGGTGGAGGT[G/T]GAGATGGTGGAGACACCGGAAGATTCACAATGAAGCTTATTTGAGCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link