LOC568973

Ensembl ID:
ENSDARG00000078525
Human Orthologue:
CCRN4L
Human Description:
CCR4 carbon catabolite repression 4-like (S. cerevisiae) [Source:HGNC Symbol;Acc:14254]
Mouse Orthologue:
Ccrn4l
Mouse Description:
CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:109382]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2026 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13425 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111026 Essential Splice Site 89 374 1 3
Genomic Location:
Chromosome 1 (position 12832943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGCMAGGAGGACCATCAGAGTCATGCAGTGGAATGTACTCGCACAAG[G/A]TACACACTCATCTTTATGCAYGCYGTCATTGAAATGTTTTAGATATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111026 Nonsense 287 374 2 3
Genomic Location:
Chromosome 1 (position 12836569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCGAGCCATCAGAAGACGTCTATAGGAATTTCGCAACATCTAGTCTG[G/T]GATTGGACAGYGCGTATAAGCTTTTGAGTAMAGATGGGAAAACTGAGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c92jc2p9