si:ch211-80h18.1

Ensembl ID:
ENSDARG00000078522
ZFIN ID:
ZDB-GENE-070705-257
Description:
hypothetical protein LOC555593 [Source:RefSeq peptide;Acc:NP_001121804]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29129 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36757 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36756 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108914   None 359 None 24
ENSDART00000122816 Essential Splice Site 148 638 10 41

The following transcripts of ENSDARG00000078522 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3673359)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3169932
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAAGTTACGATGGACAAGATGGGTCCAAATCTGAGATAGCCCCTCCAG[G/A]TACATGATGAATGAGTGAATGAATCAATGAACAAATGAATGAATGAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108914   None 359 None 24
ENSDART00000122816 Essential Splice Site 237 638 14 41

The following transcripts of ENSDARG00000078522 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3669573)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3166146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGTATTTGTTCAGGGTCGGATGGATTCTCTCCACAATATGAAAATG[G/A]TATGTGAATAACAGGGTTAGTTCTTACTTTAAATGCTGTATGAAATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108914 Nonsense 95 359 7 24
ENSDART00000122816 Nonsense 374 638 24 41

The following transcripts of ENSDARG00000078522 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 3663920)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3160493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGATAAGCGTCTCTTGTTCTGTCCTCTAGACTCTGCAGGACCGGATTA[T/A]CTCTCTGTTGACAATGGGAACGGTGATTATAGCCACTCAGTCAGTAAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link