acaca

Ensembl ID:
ENSDARG00000078512
ZFIN ID:
ZDB-GENE-060526-74
Description:
Novel protein similar to vertebrate acetyl-Coenzyme A carboxylase alpha (ACACA) [Source:UniProtKB/Tr
Human Orthologue:
ACACA
Human Description:
acetyl-CoA carboxylase alpha [Source:HGNC Symbol;Acc:84]
Mouse Orthologue:
Acaca
Mouse Description:
acetyl-Coenzyme A carboxylase alpha Gene [Source:MGI Symbol;Acc:MGI:108451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20542 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2214 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa20542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083079 Essential Splice Site 1986 2356 44 52
ENSDART00000146773 None None 1190 None 25
Genomic Location:
Chromosome 5 (position 57734291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGATCATGCAGCCATGGGCACAGAGTGTTGTCGTAGGACGGGCCAG[G/A]TAAGCACTGATTGATGCATACAACAGACACAAAAAGTATTTGAACTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2214
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083079 Nonsense 2188 2356 49 52
ENSDART00000146773 None None 1190 None 25
Genomic Location:
Chromosome 5 (position 57726582)
KASP Assay ID:
554-2696.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTGGAGAGTAAACTAAAAGAGAGAGAAGAGTTCCTGCTGCCCATATA[T/A]CATCAAGTAGCTGTTCAGTTYGCTGACCTTCATGACACACCGGGCCGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r2zilgfl