LOC100332381

Ensembl ID:
ENSDARG00000078504
Human Orthologue:
CAMK4
Human Description:
calcium/calmodulin-dependent protein kinase IV [Source:HGNC Symbol;Acc:1464]
Mouse Orthologue:
Camk4
Mouse Description:
calcium/calmodulin-dependent protein kinase IV Gene [Source:MGI Symbol;Acc:MGI:88258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21871 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109308 Essential Splice Site 165 438 6 11
Genomic Location:
Chromosome 11 (position 14973817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAATCTTCTCTATGCTGATTTGTCAATAGATGCACCACTTAAGATAG[G/A]TAACAACCTCCATACTTAACATTTAATGAGTTAAATTGTTTATATAAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cr2tu2uq