LOC557328

Ensembl ID:
ENSDARG00000078497
Human Orthologue:
TIMELESS
Human Description:
timeless homolog (Drosophila) [Source:HGNC Symbol;Acc:11813]
Mouse Orthologue:
Timeless
Mouse Description:
timeless homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1321393]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35005 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21833 Nonsense Available for shipment Available now
sa15256 Nonsense Available for shipment Available now
sa18131 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112417 Essential Splice Site 33 1278 1 30
Genomic Location (Zv9):
Chromosome 11 (position 3195169)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3146657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTTATCTGGAGGGAGACGTTTACCACAAAGAACCAGACTGCCTTGG[T/A]AATGCTTAATCCAATAGGTCAAACCTACTTCACTGCAGAAATGTGCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112417 Nonsense 38 1278 2 30
Genomic Location (Zv9):
Chromosome 11 (position 3196950)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3148438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACCCTCATAGTTGTGTTATTTTGGTTTCTAGAGAGCGTGAAGGATT[T/A]GATTCGTTACCTGAGACATGAGGATGACGCGAGGGACATCCGGCAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112417 Nonsense 112 1278 3 30
Genomic Location (Zv9):
Chromosome 11 (position 3198350)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3149838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCTTTGGAAAAATTCCAGAYGATCCRGCCTTCCGACATCACTTCCTG[C/T]AAGTGACATCATACCTTCAGGCCTATAAGGAGRTAGAATTCACATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112417 Essential Splice Site 122 1278 3 30
Genomic Location (Zv9):
Chromosome 11 (position 3198383)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3149871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGACATCACTTCCTGYAAGTGACATCATACCTTCAGGCCTATAAGGAG[G/A]TAGAATTCACATTTTTAAYRGGCTCATGACATACAKTTGAAGTCAGAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link