ADAMTS14

Ensembl ID:
ENSDARG00000078494
Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 14 [Source:HGNC Symbol;Acc:14899]
Human Orthologue:
ADAMTS14
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 14 [Source:HGNC Symbol;Acc:14899]
Mouse Orthologue:
Adamts14
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 Gene

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22180 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15424 Essential Splice Site Available for shipment Available now
sa22179 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108989 Essential Splice Site 50 917 1 24
Genomic Location:
Chromosome 12 (position 49275137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATTAAAAGGGACAAAGATCGAAGGCCAGACGAGCTCCACAATGAAGG[T/C]ATGCTGAGGAGTAATGACGGAAACCTGCAGAACTATTTTTATTATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108989 Essential Splice Site 50 917 2 24
Genomic Location:
Chromosome 12 (position 49271531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAATTCAGATGTATTTCTCTGCTTTGACACAMTGTGTTTCCTTGTTTCC[A/C]TGTTTAGTGGCAGAGTTYGGTATCGCTGAGCTGCCGAACGYTCTCAGYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108989 Essential Splice Site 794 917 21 24
Genomic Location:
Chromosome 12 (position 49225022)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACATAAAATTAACATTGCTTTTTTGTGTGTGTGTGTTGTGTGTGTA[T/A]GCAGTGTTCAGTCAGCTGTGGTGAAGGGATCCGGCAGCGGCAGGTGATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4kia08ep