NP_001124244.1

Ensembl ID:
ENSDARG00000078481
Description:
hypothetical protein LOC559344 [Source:RefSeq peptide;Acc:NP_001124244]
Human Orthologue:
C17orf101
Human Description:
chromosome 17 open reading frame 101 [Source:HGNC Symbol;Acc:26174]
Mouse Orthologue:
1110031I02Rik
Mouse Description:
RIKEN cDNA 1110031I02 gene Gene [Source:MGI Symbol;Acc:MGI:1913429]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31879 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112352 Nonsense 185 278 7 9
Genomic Location (Zv9):
Chromosome 12 (position 29886266)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28223203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTGTTTTATACCAGTGATGTCCGTGGCCGAATTCAAAAGGCAATAT[C/A]AGAGACGTTTGGTCTGGACTCCAAACAGATGTACCTCACCAAGCCCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link