NP_001099130.1

Ensembl ID:
ENSDARG00000078479
Description:
molybdenum cofactor biosynthesis protein 1 [Source:RefSeq peptide;Acc:NP_001099130]
Human Orthologue:
MOCS1
Human Description:
molybdenum cofactor synthesis 1 [Source:HGNC Symbol;Acc:7190]
Mouse Orthologue:
Mocs1
Mouse Description:
molybdenum cofactor synthesis 1 Gene [Source:MGI Symbol;Acc:MGI:1928904]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11055 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111238 Nonsense 294 349 8 9
Genomic Location (Zv9):
Chromosome 17 (position 41480508)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 41375918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TARTKTGTGNTTTACATATGTGTCTRTGTTGGCCCACTGTTAGGTTTGTT[T/A]ATTTGGKAATGCAGAGGTGTCTTTGAGAGATTTTCTGCGTTCTGGAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link