klhl23

Ensembl ID:
ENSDARG00000078475
ZFIN ID:
ZDB-GENE-081104-458
Human Orthologue:
KLHL23
Human Description:
kelch-like 23 (Drosophila) [Source:HGNC Symbol;Acc:27506]
Mouse Orthologue:
Klhl23
Mouse Description:
kelch-like 23 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683536]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10823 Nonsense Available for shipment Available now
sa10221 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114463 Nonsense 281 558 1 3
Genomic Location:
Chromosome 9 (position 49165929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACTGTTGCAAGAAGCCRACATGCAGTTTGTATGTTATCGGTGGATA[T/A]TATTGGCATCCTTTGTGCGAAGTTCACATGTGGGACCCCGTTTCCAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114463 Nonsense 461 558 3 3
Genomic Location:
Chromosome 9 (position 49122224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTGAAAAACTCAAAAGATGTCTTTCTTTTCAGAGTACGGCCTTTGCT[C/A]GGTGTCCTTAWACAATAAGCTTTATCTGGTTGGCGGTCAGACGACTATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rny78qjf