myo15ab

Ensembl ID:
ENSDARG00000078474
ZFIN ID:
ZDB-GENE-090312-149
Human Orthologue:
MYO15A
Human Description:
myosin XVA [Source:HGNC Symbol;Acc:7594]
Mouse Orthologue:
Myo15
Mouse Description:
myosin XV Gene [Source:MGI Symbol;Acc:MGI:1261811]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19418 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa16208 Essential Splice Site Available for shipment Available now
sa12896 Essential Splice Site Available for shipment Available now
sa12339 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113333 Nonsense 258 757 7 21
ENSDART00000143547 Splice Site, Nonsense 1833 2375 47 62
Genomic Location:
Chromosome 1 (position 7567448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTGCCGTGGCCTCCACTGCGGCTGCACATGAGCTAGACCCCTCACTA[G/T]AGGTAAATACAGCTGAAGTCAGAATATGGTCAATATAATTAGCCCCCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113333 None None 757 None 21
ENSDART00000143547 Essential Splice Site 1834 2375 48 62
Genomic Location:
Chromosome 1 (position 7568070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTTTGACYGATCATGCATTAATAATCTTGTRTGTTTTGTAATGGCCA[G/A]TCTGATGGAWTYGGGGATTTCGGTGACTCTGAAGCTGAAGGAAATGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113333 Essential Splice Site 287 757 None 21
ENSDART00000143547 Essential Splice Site 1873 2375 None 62
Genomic Location:
Chromosome 1 (position 7568191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGAGTTTGCCAGGAAATAYTTYAGAACATCAGATGGAAGCAAAAGG[T/C]GCTATTGCTGCTGTAATAATAATATACATATATAWWTTATTAATTYAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113333 Nonsense 481 757 15 21
ENSDART00000143547 Nonsense 2067 2375 55 62
Genomic Location:
Chromosome 1 (position 7574051)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTMGAAGCTCGAAGCGGCAGCTTTTTCTCTTTCCWGGAGGAAYTGAG[A/T]GACATTTGAAGATCAAAACTTGCTCTGTAGGTCTCCTCATATGTGTTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l09a8qid