si:dkey-169h1.9

Ensembl ID:
ENSDARG00000078466
ZFIN ID:
ZDB-GENE-091118-94
Human Orthologues:
CETN1, CETN2
Human Descriptions:
centrin, EF-hand protein, 1 [Source:HGNC Symbol;Acc:1866]
centrin, EF-hand protein, 2 [Source:HGNC Symbol;Acc:1867]
Mouse Orthologues:
Cetn1, Cetn2
Mouse Descriptions:
centrin 1 Gene [Source:MGI Symbol;Acc:MGI:1347086]
centrin 2 Gene [Source:MGI Symbol;Acc:MGI:1347085]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38986 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111643 Essential Splice Site 54 172 2 5
Genomic Location (Zv9):
Chromosome 14 (position 18562699)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14357152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTTTGACACTGATGGCTCTGGTTATATTGAGGTGAAGGAGTTAAAG[G/A]TAAGATATAATGCCACAAACACACTCTAAAATCCCTCTGATCTCCTCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link