pde6c

Ensembl ID:
ENSDARG00000078461
ZFIN ID:
ZDB-GENE-040426-1664
Description:
cone cGMP-specific 3',5'-cyclic phosphodiesterase subunit alpha' [Source:RefSeq peptide;Acc:NP_9571
Human Orthologue:
PDE6C
Human Description:
phosphodiesterase 6C, cGMP-specific, cone, alpha prime [Source:HGNC Symbol;Acc:8787]
Mouse Orthologue:
Pde6c
Mouse Description:
phosphodiesterase 6C, cGMP specific, cone, alpha prime Gene [Source:MGI Symbol;Acc:MGI:105956]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41953 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106501 Essential Splice Site 208 852 3 22
Genomic Location (Zv9):
Chromosome 12 (position 5722417)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5100621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAAGCAGACATTATTCACCATTTAGTAAATGTGTTGCGAATGTTTTTC[A/T]GGTATTCAGCAAGTACATCATATTTGCCACAGTCATCGCCCTGCAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106501 Nonsense 435 852 10 22
Genomic Location (Zv9):
Chromosome 12 (position 5713654)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5109384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCTCTAACACAGTTCCTGGGATGGTCCGTACTGAACTGCGACACATA[T/A]GACAAACTGAACCGGATGGAGTGGAGGAAAGAAATTGCAGAAGAAATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link