si:ch211-251d10.5

Ensembl ID:
ENSDARG00000078459
ZFIN ID:
ZDB-GENE-030131-5868
Human Orthologue:
CUX1
Human Description:
cut-like homeobox 1 [Source:HGNC Symbol;Acc:2557]
Mouse Orthologue:
Cux1
Mouse Description:
cut-like homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:88568]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21765 Essential Splice Site Available for shipment Available now
sa34940 Nonsense Mutation detected in F1 DNA During 2017
sa21764 Nonsense Available for shipment Available now
sa18988 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081170 Essential Splice Site 262 1495 9 26
ENSDART00000136245   None 223 None 5
Genomic Location (Zv9):
Chromosome 10 (position 33939826)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33041175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAATGAGATTGAAGCGGTGATGACAGACTTGGAAAGAGCCAATCAGG[T/C]AAAAGACCATATTCCTCATGGAAAAGCCACTCGTATTTCTATTGTATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081170 Nonsense 343 1495 11 26
ENSDART00000136245   None 223 None 5
Genomic Location (Zv9):
Chromosome 10 (position 33934655)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33036004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTCAGCTCAGCGAGACATCAACCAACCAGATCAGCCAGCTCGAGCAG[C/T]AGCTCAGCTCCAAAGAGGCACTACTAAAGGTCAGTCCAGCCAGCCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081170 Nonsense 1120 1495 23 26
ENSDART00000136245 Nonsense 35 223 1 5
Genomic Location (Zv9):
Chromosome 10 (position 33875379)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32976728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCCCCCTGAGCTCGGCTGAGGAGTCTGTGAAGAGCCAGCAGGAGGAG[C/T]AGATGTGCCGATCCTCCGTCCAGGAGCCCAGCGAAGCCTCCGAGTCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081170 Nonsense 1225 1495 24 26
ENSDART00000136245 Nonsense 140 223 2 5
Genomic Location (Zv9):
Chromosome 10 (position 33867554)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32968903
KASP Assay ID:
2260-3424.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAGCTCAGCCTGAAGGGTCGCGAGCCGTTCGTGCGCATGCAGCTGTG[G/A]TTGAGCGACCCGCGCAACGTGGAGAAGCTGATGGACATGAAGCGCATGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link