asb2b

Ensembl ID:
ENSDARG00000078445
ZFIN IDs:
ZDB-GENE-040426-20, ZDB-GENE-040426-20
Description:
ankyrin repeat and SOCS box-containing protein 2 [Source:RefSeq peptide;Acc:NP_999890]
Human Orthologue:
ASB2
Human Description:
ankyrin repeat and SOCS box-containing 2 [Source:HGNC Symbol;Acc:16012]
Mouse Orthologue:
Asb2
Mouse Description:
ankyrin repeat and SOCS box-containing 2 Gene [Source:MGI Symbol;Acc:MGI:1929743]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23198 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114369 Nonsense 450 563 7 8
ENSDART00000126788 Nonsense 450 517 7 7
Genomic Location:
Chromosome 17 (position 53910382)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGTGTGTGTGTGTGTGTGTGTGTGTTCTCCTGCAGTTCTGCGAGTG[G/A]CTCTGCTCGTCCCGCTCTGCTCCCTCTGCTGGTGGTTTGGTGGATCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u2brw96x