si:dkey-117i20.1

Ensembl ID:
ENSDARG00000078441
ZFIN ID:
ZDB-GENE-091204-125
Human Orthologue:
PPIP5K2
Human Description:
diphosphoinositol pentakisphosphate kinase 2 [Source:HGNC Symbol;Acc:29035]
Mouse Orthologue:
Ppip5k2
Mouse Description:
diphosphoinositol pentakisphosphate kinase 2 Gene [Source:MGI Symbol;Acc:MGI:2142810]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34833 Nonsense Available for shipment Available now
sa34832 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15105 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109744 Nonsense 234 1242 6 29
ENSDART00000141047   None 187 None 8
ENSDART00000144001 Nonsense 234 1224 6 28

The following transcripts of ENSDARG00000078441 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6518306)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6894934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTTTGGCTCATTTCTGTTCACGTTTGATCCGTTTCAGATTGGCAGC[A/T]GAAGTAGTGTCTATTCTCCTGAGAGTAATGTCAGAAAGACTGGATCCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109744 Essential Splice Site 264 1242 6 29
ENSDART00000141047   None 187 None 8
ENSDART00000144001 Essential Splice Site 264 1224 6 28

The following transcripts of ENSDARG00000078441 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6518213)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6894841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCTACATTTATGAGGAGTTCATGCCTACTGATGGAACGGATGTGAAG[G/A]TATCTCAGCCTGCATTTTCTTTAACAGAGGCTGTCGTTTGATGTTTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109744 Nonsense 1047 1242 24 29
ENSDART00000141047   None 187 None 8
ENSDART00000144001   None 1224 None 28

The following transcripts of ENSDARG00000078441 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 6481324)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6857952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTCTCCCCCAAATCACTGGCTTTCACATCCAGTATTTTTGGCTCATG[G/A]CAACAGGTTTTTACCAATTTAATTCATTCTTCACAYCAACCACTAACGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link