LOC100329473

Ensembl ID:
ENSDARG00000078440
Human Orthologue:
CCDC88A
Human Description:
coiled-coil domain containing 88A [Source:HGNC Symbol;Acc:25523]
Mouse Orthologue:
Ccdc88a
Mouse Description:
coiled coil domain containing 88A Gene [Source:MGI Symbol;Acc:MGI:1925177]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12136 Essential Splice Site Available for shipment Available now
sa17212 Nonsense Available for shipment Available now
sa11239 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Essential Splice Site 54 1255 2 24
Genomic Location:
Chromosome 6 (position 6260814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGAATTAATAGATGGCATATTCCTGAACAAAGTCATGAATCAGATG[T/G]AAGTAYATGTCCATCTGCACACAGTTATTTTATCTAAGCACTTCAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Nonsense 180 1255 7 24
Genomic Location:
Chromosome 6 (position 6247698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGGAGAATGTGTTTGATCTGCACTGGTTGGAGATGGAGGGACTGTG[T/A]CCGGARGAATGGGAAAACCTCTGCAGAAGTTTGTCCGTTAAYCTCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Nonsense 591 1255 13 24
Genomic Location:
Chromosome 6 (position 6234048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAGATATTCAAAACCAAAGTATAACGCATGAGAAYGGATATCTGGAG[C/T]AAGATAAGAGTTCCCTGGAGAAGGAGAACCGGAGATTGCGGCARCAAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8rnvd8ya