LOC100329473

Ensembl ID:
ENSDARG00000078440
Human Orthologue:
CCDC88A
Human Description:
coiled-coil domain containing 88A [Source:HGNC Symbol;Acc:25523]
Mouse Orthologue:
Ccdc88a
Mouse Description:
coiled coil domain containing 88A Gene [Source:MGI Symbol;Acc:MGI:1925177]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12136 Essential Splice Site Available for shipment Available now
sa40629 Nonsense Mutation detected in F1 DNA During 2016
sa17212 Nonsense Available for shipment Available now
sa26670 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11239 Nonsense Available for shipment Available now
sa33796 Nonsense Mutation detected in F1 DNA During 2016
sa38537 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Essential Splice Site 54 1255 2 24
Genomic Location (Zv9):
Chromosome 6 (position 6260814)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6186830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGAATTAATAGATGGCATATTCCTGAACAAAGTCATGAATCAGATG[T/G]AAGTAYATGTCCATCTGCACACAGTTATTTTATCTAAGCACTTCAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Nonsense 65 1255 3 24
Genomic Location (Zv9):
Chromosome 6 (position 6256351)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6182367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTCTTTTTTTCGCAGAAATCCTGAAGGAACTGTTCAAGGTTTAAAC[A/T]AAGTAAACAATGACATCGGCCAAAGAGCTCAAAACCTGTCTGTGCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Nonsense 180 1255 7 24
Genomic Location (Zv9):
Chromosome 6 (position 6247698)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6173714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGGAGAATGTGTTTGATCTGCACTGGTTGGAGATGGAGGGACTGTG[T/A]CCGGARGAATGGGAAAACCTCTGCAGAAGTTTGTCCGTTAAYCTCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Essential Splice Site 393 1255 12 24
Genomic Location (Zv9):
Chromosome 6 (position 6235446)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6161462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGTTTTTTTTATATGTAAGCTTGACTTGGCTGTCTAATGTGTTTTA[G/A]GAAAGAACTGCAAACAGGAGGCAAATAGAGGAGCTGATGGAAAGGAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Nonsense 591 1255 13 24
Genomic Location (Zv9):
Chromosome 6 (position 6234048)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6160064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAGATATTCAAAACCAAAGTATAACGCATGAGAAYGGATATCTGGAG[C/T]AAGATAAGAGTTCCCTGGAGAAGGAGAACCGGAGATTGCGGCARCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Nonsense 685 1255 14 24
Genomic Location (Zv9):
Chromosome 6 (position 6233686)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6159702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCTAGGAGCTTCTGGATCAGAGGCTGAAACTTCAACAGAAAGAATG[T/A]GATGTTGAGAAGTACATCTATGAACTAGAGAGGATGAGGTTGAACCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115018 Essential Splice Site 1149 1255 23 24
Genomic Location (Zv9):
Chromosome 6 (position 6220790)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6146806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATAAAAAAATCAATGTTCCTGGATTTATCATGCAAACACTCTCCAAAC[A/T]GACGGGGGAACTGGATAACACTGAAGATGAGGAAGCTGATGAAGACCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link