tiam1

Ensembl ID:
ENSDARG00000078430
ZFIN ID:
ZDB-GENE-080325-1
Human Orthologue:
TIAM1
Human Description:
T-cell lymphoma invasion and metastasis 1 [Source:HGNC Symbol;Acc:11805]
Mouse Orthologue:
Tiam1
Mouse Description:
T-cell lymphoma invasion and metastasis 1 Gene [Source:MGI Symbol;Acc:MGI:103306]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21737 Nonsense Available for shipment Available now
sa1492 Nonsense Available for shipment Available now
sa16005 Nonsense Available for shipment Available now
sa11659 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 290 1621 1 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Nonsense 290 1572 2 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 26259283)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCGTACACTCTTCCCTGTCGTCGCTCTCACTGCCTGTCAGAAGGGT[T/A]GTCCAATCACCAGACTACCATCTGCTCACGTATGCAGGGACGACGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 1154 1621 17 25
ENSDART00000131640 Nonsense 177 260 5 6
ENSDART00000143978 Nonsense 1105 1572 17 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 26217101)
KASP Assay ID:
554-1417.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAACCTTCAGAAAGTTCTGTTTTCTCTTGGYGGATCTTTCCTCTACTA[T/A]GCGGACCGTTTTAAGATCTACAGTGCATTTTGTGCMAGTCACACAAAAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 1414 1621 24 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Nonsense 1365 1572 24 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 26209530)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGAGTAAAAAAGACTTCTTAAAGACTGTYCATTCCATCCTGAGGGAC[A/T]AACAACGGCGCCAGCTTATGAAGACCGAAAGTTTACCTCCAAATCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 1575 1621 25 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Nonsense 1526 1572 25 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 26208756)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGAAGGAGATGAAGACAAGGGTCTYAACGGGCTCTCCGAGGACAAAT[C/A]GAAGAAATCYCACGCCCCCTTGAAACTGACCCTTCTGAGAAAGCAATGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/axndv4ku