LOC100333796

Ensembl ID:
ENSDARG00000078428
Human Orthologues:
HTR3A, HTR3B, HTR3C, HTR3D, HTR3E, ZACN
Human Descriptions:
5-hydroxytryptamine (serotonin) receptor 3 family member D [Source:HGNC Symbol;Acc:24004]
5-hydroxytryptamine (serotonin) receptor 3, family member C [Source:HGNC Symbol;Acc:24003]
5-hydroxytryptamine (serotonin) receptor 3, family member E [Source:HGNC Symbol;Acc:24005]
5-hydroxytryptamine (serotonin) receptor 3A [Source:HGNC Symbol;Acc:5297]
5-hydroxytryptamine (serotonin) receptor 3B [Source:HGNC Symbol;Acc:5298]
zinc activated ligand-gated ion channel [Source:HGNC Symbol;Acc:29504]
Mouse Orthologues:
Htr3a, Htr3b
Mouse Descriptions:
5-hydroxytryptamine (serotonin) receptor 3A Gene [Source:MGI Symbol;Acc:MGI:96282]
5-hydroxytryptamine (serotonin) receptor 3B Gene [Source:MGI Symbol;Acc:MGI:1861899]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33334 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108979 Nonsense 394 412 9 9
Genomic Location (Zv9):
Chromosome 3 (position 58998981)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58060656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGATAAAAGTGGCAAGAATAACAGACATGATGTTCTTGATTCTCTA[T/A]CTACTCACCATTGTTGTGTTTCTGTCTGTGCTTGGGAAAGTTTGGTACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link