ENSDARG00000078427

Ensembl ID:
ENSDARG00000078427
Mouse Orthologues:
Gm10891, Gm10893, Gm10909, Gm13896, Gm13926, Gm13979, Gm16591, Gm16837, Gm16940, Gm17015, Gm6037, Gm6683
Mouse Descriptions:
predicted gene 10891 Gene [Source:MGI Symbol;Acc:MGI:3800299]
predicted gene 10893 Gene [Source:MGI Symbol;Acc:MGI:3704436]
predicted gene 10909 Gene [Source:MGI Symbol;Acc:MGI:3642826]
predicted gene 13896 Gene [Source:MGI Symbol;Acc:MGI:3702130]
predicted gene 13926 Gene [Source:MGI Symbol;Acc:MGI:3702147]
predicted gene 13979 Gene [Source:MGI Symbol;Acc:MGI:3651288]
predicted gene 17015 Gene [Source:MGI Symbol;Acc:MGI:4819748]
predicted gene 6037 Gene [Source:MGI Symbol;Acc:MGI:3649172]
predicted gene 6683 Gene [Source:MGI Symbol;Acc:MGI:3704133]
predicted gene, 16591 Gene [Source:MGI Symbol;Acc:MGI:4439369]
predicted gene, 16837 Gene [Source:MGI Symbol;Acc:MGI:4439761]
predicted gene, 16940 Gene [Source:MGI Symbol;Acc:MGI:4439864]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30824 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39878 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25116 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Essential Splice Site 17 113 2 2
ENSDART00000110378 Essential Splice Site 17 113 2 2
Genomic Location:
Chromosome 2 (position 36214973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATAATAATTCATGTTAATGATATCTACTTTTTCTGTTATACTTTCC[A/G]GTGTGCAGAGGACAAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Essential Splice Site 17 113 2 2
ENSDART00000110378 Essential Splice Site 17 113 2 2
Genomic Location:
Chromosome 2 (position 36214973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATAATAATTCATGTTAATGATATCTACTTTTTCTGTTATACTTTCC[A/G]GTGTGCAGAGGACAAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Nonsense 21 113 2 2
Genomic Location:
Chromosome 2 (position 36214960)
KASP Assay ID:
554-7837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTTAATGATATCTACTTTTTCTGTTATACTTTCCAGTGTGCAGAGGA[C/T]AAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGACAGTGAAGGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link