filip1

Ensembl ID:
ENSDARG00000078419
ZFIN ID:
ZDB-GENE-030131-4110
Human Orthologue:
FILIP1
Human Description:
filamin A interacting protein 1 [Source:HGNC Symbol;Acc:21015]
Mouse Orthologue:
Filip1
Mouse Description:
filamin A interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36532 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112267 Nonsense 279 451 1 2
Genomic Location (Zv9):
Chromosome 17 (position 50531469)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49917394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCGCATCCAACAGCAGCTCCCAGGAGTCTGTGGACATGATAACAGGC[A/T]GAGCTGTGTTCAAGGAAACTCCTGAGAAACGAATGGTCCCCACACCCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link