hspb15

Ensembl ID:
ENSDARG00000078411
ZFIN ID:
ZDB-GENE-080214-5
Description:
heat shock protein, alpha-crystallin-related, b15 [Source:RefSeq peptide;Acc:NP_001092202]
Human Orthologue:
HSPB1
Human Description:
heat shock 27kDa protein 1 [Source:HGNC Symbol;Acc:5246]
Mouse Orthologue:
Hspb1
Mouse Description:
heat shock protein 1 Gene [Source:MGI Symbol;Acc:MGI:96240]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20464 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110804 Nonsense 32 154 1 3
Genomic Location (Zv9):
Chromosome 5 (position 33960613)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31722845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAACCATGTTCTGGATCTGAAGGACACGTTTCTGATGCTGTGTGTGAA[C/T]AAATGATAGGAGAGCAAGACTGGAAAGTTTGTCTAGATGTCGGTCCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link