ENSDARG00000078410

Ensembl ID:
ENSDARG00000078410

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40454 Nonsense Mutation detected in F1 DNA During 2017
sa26490 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114745 Nonsense 115 315 1 1
Genomic Location (Zv9):
Chromosome 5 (position 31176566)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28937923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATTAGCAGCAGTATTCTGTTTCTCACTTCCATTAGCATTCATCGCTA[T/A]GTGGCTGTGGTGCGCTTTAACCGAGACTCTTACATGAATCAAAAAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114745 Nonsense 173 315 1 1
Genomic Location (Zv9):
Chromosome 5 (position 31176394)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28937751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAAGCATTGTGAACAATCACACTTTATGCCTCAGTGTTCACCAAGGA[C/T]AGTATATCGACATTTATATAATGGTAAACTTCATCATCGTAATTCCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link