larp4a

Ensembl ID:
ENSDARG00000078401
ZFIN ID:
ZDB-GENE-090313-50
Human Orthologue:
LARP4
Human Description:
La ribonucleoprotein domain family, member 4 [Source:HGNC Symbol;Acc:24320]
Mouse Orthologue:
Larp4
Mouse Description:
La ribonucleoprotein domain family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2443114]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13614 Nonsense Available for shipment Available now
sa11471 Nonsense Available for shipment Available now
sa4241 Nonsense Mutation detected in F1 DNA During 2014
sa9281 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115170 Nonsense 279 773 8 16
ENSDART00000135023 None None 206 None 5
ENSDART00000144419 Nonsense 279 787 8 17
ENSDART00000115170 Nonsense 279 773 8 16
ENSDART00000135023 None None 206 None 5
ENSDART00000144419 Nonsense 279 787 8 17
Genomic Location:
Chromosome 23 (position 27762776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCTAAAATTGAATTGAGTTTCTTTGTCTTCACCCAGGCATACAGATA[T/G]TTAAGGGAAGAAGKCAAGACATTTCAGGGAAAACCAATCATGGTAAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115170 Nonsense 279 773 8 16
ENSDART00000135023 None None 206 None 5
ENSDART00000144419 Nonsense 279 787 8 17
ENSDART00000115170 Nonsense 279 773 8 16
ENSDART00000135023 None None 206 None 5
ENSDART00000144419 Nonsense 279 787 8 17
Genomic Location:
Chromosome 23 (position 27762776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCTAAAATTGAATTGAGTTTCTTTGTCTTCACCCAGGCATACAGATA[T/G]TTAAGGGAAGAAGKCAAGACATTTCAGGGAAAACCAATCATGGTAAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115170 Nonsense 656 773 16 16
ENSDART00000135023 None None 206 None 5
ENSDART00000144419 Nonsense 670 787 17 17
Genomic Location:
Chromosome 23 (position 27752711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCCTCTTCTCTTCAGGAACCTCGCAAGCTCAGTTACGCTGAAGTATG[T/A]CAGCGACCACCTAAAGATCCCCCTCCTCCAGCATCCTCTTCCAGCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115170 Nonsense 740 773 16 16
ENSDART00000135023 None None 206 None 5
ENSDART00000144419 Nonsense 754 787 17 17
Genomic Location:
Chromosome 23 (position 27752461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCGCAGCAACGGACYCCCCAGAAGCAGTACAGGGGGGTTCAAGCTA[C/T]GAGAGCARCAGAGACGCCCTCCCTTCGGCCATCGCGGTTCCCCCCAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4cb4gh69