LOC100332846

Ensembl ID:
ENSDARG00000078399
Human Orthologues:
ACSL1, ACSL5, ACSL6
Human Descriptions:
acyl-CoA synthetase long-chain family member 1 [Source:HGNC Symbol;Acc:3569]
acyl-CoA synthetase long-chain family member 5 [Source:HGNC Symbol;Acc:16526]
acyl-CoA synthetase long-chain family member 6 [Source:HGNC Symbol;Acc:16496]
Mouse Orthologues:
Acsl1, Acsl5, Acsl6
Mouse Descriptions:
acyl-CoA synthetase long-chain family member 1 Gene [Source:MGI Symbol;Acc:MGI:102797]
acyl-CoA synthetase long-chain family member 5 Gene [Source:MGI Symbol;Acc:MGI:1919129]
acyl-CoA synthetase long-chain family member 6 Gene [Source:MGI Symbol;Acc:MGI:894291]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12007 Essential Splice Site Available for shipment Available now
sa18353 Nonsense Available for shipment Available now
sa15288 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053750 Essential Splice Site 280 685 7 19
Genomic Location:
Chromosome 8 (position 53109523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTGCTTCACAGGATCTGGGAAGAGAAAATTTAAAGCCACCTGTGG[T/C]AAGAGCTTCTTTTAATTTCCCTTCATTAMTTAAAGGACTTTCAGCAYGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053750 Nonsense 438 685 12 19
Genomic Location:
Chromosome 8 (position 53102515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCGTGAGGAACAMCAGCCTGTGGGACAGACTCATCTTCAATAAGATA[C/T]AGGTATAAGACTCGTAAGGTGTTTTTGGAAAAATAAAGATAYATRCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053750 Nonsense 560 685 16 19
Genomic Location:
Chromosome 8 (position 53099117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCARAGGCTCTGGACACTGAAGGGTGGCTTCACACTGGAGACGTGGGA[C/T]AATGGCTGCCTGTGAGACTTTAAACAACTTTCACAACACTGACATTCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f2h4qhul