NP_956917.1

Ensembl ID:
ENSDARG00000078396
Description:
WD repeat-containing protein 46 [Source:RefSeq peptide;Acc:NP_956917]
Human Orthologue:
WDR46
Human Description:
WD repeat domain 46 [Source:HGNC Symbol;Acc:13923]
Mouse Orthologue:
Wdr46
Mouse Description:
WD repeat domain 46 Gene [Source:MGI Symbol;Acc:MGI:1931871]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38222 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38223 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023316 Essential Splice Site 63 164 2 5
Genomic Location (Zv9):
Chromosome Zv9_NA913 (position 23700)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53203692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACCCCACACAGAGAAGAGGAAGAAAGAAGAACGTTTACTGTCAGGGG[T/A]AAAAGTTTTCTCTTTGCTAATTAAGCTAAAGTTGGTTTTATATTTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023316 Essential Splice Site 90 164 3 5
Genomic Location (Zv9):
Chromosome Zv9_NA913 (position 23913)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53203905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACAGAAGCAGCTGCGCACGTTTCAGAGAGGACAGAAACACAAAGTGG[T/C]GAGTCATGAATCGACATTTAGGGCTCGACGATGTGGACCACAATTCATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link